per1b

Ensembl ID:
ENSDARG00000012499
ZFIN ID:
ZDB-GENE-040419-1
Description:
period homolog 1b [Source:RefSeq peptide;Acc:NP_997604]
Human Orthologue:
PER1
Human Description:
period homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:8845]
Mouse Orthologue:
Per1
Mouse Description:
period homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1098283]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31594 Nonsense Available for shipment Available now
sa41011 Nonsense Mutation detected in F1 DNA During 2017
sa41012 Nonsense Mutation detected in F1 DNA During 2017
sa21065 Essential Splice Site Available for shipment Available now
sa21066 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31594
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011082 Nonsense 939 1398 15 19
Genomic Location (Zv9):
Chromosome 7 (position 52296435)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50566185
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGTCCTGGCCCACATCAGGGTCACAAGCCAGCGTTCCCAATGTCCAATA[T/A]CCACCCACCGTCCTTCCTTTTTATCCAGTCTATCCCCCAATCTCCCATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41011
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011082 Nonsense 1115 1398 15 19
Genomic Location (Zv9):
Chromosome 7 (position 52296962)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50566712
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGCTGGAGGACAGGCCTCGTCTAACCAGAGAGGGTCAGCGGTGGATT[C/A]AAAAACAAACGAAAATGTAAGTAGTTAAAAAGAAAATTTGATTTAGGTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41012
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011082 Nonsense 1257 1398 18 19
Genomic Location (Zv9):
Chromosome 7 (position 52298982)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50568732
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATTGACCCAGTATATGTCTTTTTTTCAACAGAGACAGAGATTCAGTGT[T/A]GAAAGAGGACCGAGCTGCGCTGAGAGCCATGCAGAAACATCAGCCTCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21065
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011082 Essential Splice Site 1301 1398 18 19
Genomic Location (Zv9):
Chromosome 7 (position 52299116)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50568866
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCACCCATGGATCCGCACCGGACGCCTTCCTCGTGCCATTAACATTTCA[G/A]TGAGTTCAATTCTCAGACAGTAACTCCCAAAATGATAACACTCAGGTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21066
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011082 Nonsense 1368 1398 19 19
Genomic Location (Zv9):
Chromosome 7 (position 52299403)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50569153
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGACAAAATGAGACATGCAAAGAGAACAATGGGACTGTTACGACAGCA[C/T]AAATCAATGATCAAGAAATGCTGACGGAAGAACAGGAAATGACCTCGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link