mphosph10

Ensembl ID:
ENSDARG00000012495
ZFIN ID:
ZDB-GENE-030131-2146
Human Orthologues:
AC007342.1, MPHOSPH10
Human Description:
M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein) [Source:HGNC Symbol;Acc:7213]
Mouse Orthologue:
Mphosph10
Mouse Description:
M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein) Gene [Source:MGI Symbol;Acc:MGI:191

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa371 Nonsense Available for shipment Available now
sa13196 Essential Splice Site Available for shipment Available now
sa15514 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa371
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004782 Nonsense 184 695 2 11
Genomic Location:
Chromosome 7 (position 32115092)
KASP Assay ID:
554-0243.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGATTTGGACTTTGATGTAGATAAATTTGAGAAACAAACCAAACAGAGA[C/T]AGTCTGCTGCTGGCAAGTTAACAAAATCTAAACCGAACTGGACTCAGTCT
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Control on top; Mutant below; 5 dpf

Control on top; Mutant below; 5 dpf

zoom

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
pericardium
ZFA:0000054
edematous
PATO:0001450
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
necrotic
PATO:0000647
abnormal
PATO:0000460

Mutation Details

Allele Name:
sa13196
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004782 Essential Splice Site 258 695 2 11
Genomic Location:
Chromosome 7 (position 32114866)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACGATGAACTGAGCTTTGATAAACCAGTCGTGAAGAAGAAACTYAAGG[T/A]AATGGTGTTTATTTTAAGCAGYAACATASTTCTTTGTGTTATTTTGATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15514
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004782 Nonsense 464 695 7 11
Genomic Location:
Chromosome 7 (position 32111892)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGATGATGTGGTCAGGAAAGAGAAGCCTAAAGAAGAGGTGTTTGAGTA[T/A]AARAAGAGACTSACTCTGGATCAKGAGAAGAGCAAACTGAGTCTGGCTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dtlhspfg