senp6a

Ensembl ID:
ENSDARG00000012493
ZFIN IDs:
ZDB-GENE-050309-69, ZDB-GENE-080204-25
Description:
Zgc:171230 protein [Source:UniProtKB/TrEMBL;Acc:A8WFR2]
Human Orthologue:
SENP6
Human Description:
SUMO1/sentrin specific peptidase 6 [Source:HGNC Symbol;Acc:20944]
Mouse Orthologue:
Senp6
Mouse Description:
SUMO/sentrin specific peptidase 6 Gene [Source:MGI Symbol;Acc:MGI:1922075]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23615 Essential Splice Site Available for shipment Available now
sa23616 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23615
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126849 Essential Splice Site 891 1035 20 23
ENSDART00000129454   None 122 None 2
Genomic Location (Zv9):
Chromosome 20 (position 730824)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 687013
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAGCTTCGACAGAGCAGAGTGGACCTCCAAACCCACCATCTGCAAACA[G/A]TCAGTGCAGATAATTCCTCACATATTATTGTGAACGCGCGTACAAGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23616
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126849 Nonsense 1026 1035 23 23
ENSDART00000129454 Nonsense 113 122 2 2
Genomic Location (Zv9):
Chromosome 20 (position 735336)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 691201
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGATCAGACGGACGGCGCTCACAGCCCTTACGAGGACTCTCTGGAGT[C/A]AGCAGACCTCATCCCATCAGTCAGCTCCTGAGCTCCGTCACATGACCAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link