PDE1C (1 of 2)

Ensembl ID:
ENSDARG00000012490
Description:
phosphodiesterase 1C, calmodulin-dependent 70kDa [Source:HGNC Symbol;Acc:8776]
Human Orthologue:
PDE1C
Human Description:
phosphodiesterase 1C, calmodulin-dependent 70kDa [Source:HGNC Symbol;Acc:8776]
Mouse Orthologue:
Pde1c
Mouse Description:
phosphodiesterase 1C Gene [Source:MGI Symbol;Acc:MGI:108413]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30436 Essential Splice Site Mutation detected in F1 DNA During 2017
sa30437 Essential Splice Site Mutation detected in F1 DNA During 2017
sa24781 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30436
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067655 Essential Splice Site 34 402 1 11
Genomic Location (Zv9):
Chromosome Zv9_NA797 (position 32744)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 50743651
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTGCAACCCGACCAAATCGAGAAAATCTGGCTCCGACTGCGAGGACTG[T/C]GAGTATCAGCTTTTCAACAGGTTTTCTTGTGTTTGTGTTTTAAACATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30437
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067655 Essential Splice Site 284 402 9 11
Genomic Location (Zv9):
Chromosome Zv9_NA797 (position 107331)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 50818238
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGGGTTAGTGCAGAATGTATGTGAGATGAGTGTGTGTTGACTGGTAC[A/G]GGTCAGACGCAGCGATCCTGTACAACGACCGCTCGGTGCTGGAGTCCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24781
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067655 Nonsense 291 402 9 11
Genomic Location (Zv9):
Chromosome Zv9_NA797 (position 107354)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 50818261
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAGATGAGTGTGTGTTGACTGGTACAGGTCAGACGCAGCGATCCTGTA[C/A]AACGACCGCTCGGTGCTGGAGTCCCATCATGTGAGCGCCTCGTATCGACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link