aurka

Ensembl ID:
ENSDARG00000012485
ZFIN IDs:
ZDB-GENE-040801-161, ZDB-GENE-040801-161
Description:
serine/threonine-protein kinase 6 [Source:RefSeq peptide;Acc:NP_001003640]
Human Orthologue:
AURKA
Human Description:
aurora kinase A [Source:HGNC Symbol;Acc:11393]
Mouse Orthologue:
Aurka
Mouse Description:
aurora kinase A Gene [Source:MGI Symbol;Acc:MGI:894678]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2294 Nonsense F2 line generated During 2016
sa38587 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa2294
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008224 Nonsense 353 405 9 9
ENSDART00000129708 Nonsense 353 405 8 9
Genomic Location (Zv9):
Chromosome 6 (position 59803464)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 60144280
KASP Assay ID:
554-2638.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCACATCGTCACCATATCTCNTGTTTGTTTTTAGGTTGAGTTTACTTA[T/A]CCAGCTCATGTGAGCAAYGGCAGCAGAGACCTGATCAATCGACTACTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38587
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008224   None 405 9 9
ENSDART00000129708 Essential Splice Site None 405 8 9
Genomic Location (Zv9):
Chromosome 6 (position 59803789)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 60144605
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGTTTTTACATGTTGTGCTGTTTATGTGCTTCAGTTTGCAAGTATTT[G/T]TAAATATGTAATTAAGACAATTTGTAAAGTTGTATCCATTACTTGAAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link