aacs

Ensembl ID:
ENSDARG00000012468
ZFIN ID:
ZDB-GENE-040426-903
Description:
Acetoacetyl-CoA synthetase [Source:UniProtKB/Swiss-Prot;Acc:A3QK15]
Human Orthologue:
AACS
Human Description:
acetoacetyl-CoA synthetase [Source:HGNC Symbol;Acc:21298]
Mouse Orthologue:
Aacs
Mouse Description:
acetoacetyl-CoA synthetase Gene [Source:MGI Symbol;Acc:MGI:1926144]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20372 Nonsense Available for shipment Available now
sa40383 Essential Splice Site Mutation detected in F1 DNA During 2016
sa38456 Nonsense Mutation detected in F1 DNA During 2016
sa33560 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa20372
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010101 Nonsense 31 673 1 18
ENSDART00000099434 Nonsense 31 659 1 19
Genomic Location (Zv9):
Chromosome 5 (position 20681071)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18393530
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCGAAGGTGCTCTGGTACCCGGACTCCAAGCGAAACACACAGACGGAC[C/T]GATTCCGAACTCTGGTTAACCGGGAATTCGGCTTGAACCTGGGTGAGTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40383
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010101 Essential Splice Site 45 673 1 18
ENSDART00000099434 Essential Splice Site 45 659 1 19
Genomic Location (Zv9):
Chromosome 5 (position 20681027)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18393486
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGACCGATTCCGAACTCTGGTTAACCGGGAATTCGGCTTGAACCTGGG[T/C]GAGTAGAGAGTCAGCCTGGGCTTGGTTGAATGTAGACTAACTACACACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38456
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010101 Nonsense 420 673 12 18
ENSDART00000099434 Nonsense 406 659 13 19
Genomic Location (Zv9):
Chromosome 5 (position 20627711)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18340170
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCTCCACACACTCCTGTCTACAGGATCCCCACTGAAGCCCCAGAGCTA[T/A]GAATATGTGTACAGCTGTATTAAGAACAACGTGCTCCTGGGATCTATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33560
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010101 Nonsense 588 673 17 18
ENSDART00000099434 Nonsense 574 659 18 19
Genomic Location (Zv9):
Chromosome 5 (position 20612153)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18324612
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGTCCCTCAGTACAACAGTGACGGAGAAGAGAGGGTGATTCTGTTTT[T/A]GAAAATGGGACCCAATAAGAGCTTTAGCCAGGAGCTAGTAGGAAAGATCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link