aacs

Ensembl ID:
ENSDARG00000012468
ZFIN ID:
ZDB-GENE-040426-903
Description:
Acetoacetyl-CoA synthetase [Source:UniProtKB/Swiss-Prot;Acc:A3QK15]
Human Orthologue:
AACS
Human Description:
acetoacetyl-CoA synthetase [Source:HGNC Symbol;Acc:21298]
Mouse Orthologue:
Aacs
Mouse Description:
acetoacetyl-CoA synthetase Gene [Source:MGI Symbol;Acc:MGI:1926144]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20372 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20372
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010101 Nonsense 31 673 1 18
ENSDART00000099434 Nonsense 31 659 1 19
Genomic Location:
Chromosome 5 (position 20681071)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCGAAGGTGCTCTGGTACCCGGACTCCAAGCGAAACACACAGACGGAC[C/T]GATTCCGAACTCTGGTTAACCGGGAATTCGGCTTGAACCTGGGTGAGTAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/j9uem2mo