tmem49

Ensembl ID:
ENSDARG00000012450
ZFIN ID:
ZDB-GENE-030131-8733
Description:
Transmembrane protein 49 [Source:UniProtKB/Swiss-Prot;Acc:Q6NYY9]
Human Orthologue:
TMEM49
Human Description:
transmembrane protein 49 [Source:HGNC Symbol;Acc:29559]
Mouse Orthologue:
Tmem49
Mouse Description:
transmembrane protein 49 Gene [Source:MGI Symbol;Acc:MGI:1923159]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3910 Nonsense Mutation detected in F1 DNA During 2014
sa10666 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3910
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018461 Nonsense 96 406 4 12
ENSDART00000111753 Nonsense 96 149 4 7

The following transcripts of ENSDARG00000012450 do not overlap with this mutation:

Genomic Location:
Chromosome 15 (position 16369076)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAWTTCTGACAGTAGTCCTTTTTTCACTTTTCTCACTGGCTTATTCAATA[G/T]AAGGAGCACATCAGGAGGTGAGCTCAACATTGACCTTTTCCCCYGTCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10666
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018461 Nonsense 319 406 10 12
ENSDART00000111753 None None 149 None 7

The following transcripts of ENSDARG00000012450 do not overlap with this mutation:

Genomic Location:
Chromosome 15 (position 16384268)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTGCAGAAACTGTTTGTTATCATTACGTTCAGCAAGCACATAGTGGAG[C/T]AGATGGTGTCTCTGATCGGGTGAGTAACAATGGACAGACAGTGCTAAACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ihjsg696