tmem49

Ensembl ID:
ENSDARG00000012450
ZFIN ID:
ZDB-GENE-030131-8733
Description:
Transmembrane protein 49 [Source:UniProtKB/Swiss-Prot;Acc:Q6NYY9]
Human Orthologue:
TMEM49
Human Description:
transmembrane protein 49 [Source:HGNC Symbol;Acc:29559]
Mouse Orthologue:
Tmem49
Mouse Description:
transmembrane protein 49 Gene [Source:MGI Symbol;Acc:MGI:1923159]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35848 Splice Site, Nonsense Mutation detected in F1 DNA During 2016
sa32025 Essential Splice Site, Missense Mutation detected in F1 DNA During 2016
sa10666 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35848
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018461 Splice Site, Nonsense 102 406 5 12
ENSDART00000111753 Splice Site, Nonsense 102 149 5 7

The following transcripts of ENSDARG00000012450 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 16369331)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 17414294
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTGCATCTTCTCTTTGTGATCTGGATGTGTTTGCTGTTGTTTGTAGTA[T/A]GTGCAGCACCTGGAGAAGAAGTTCCTGTGGTGTGCCTACTGGGTAGGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32025
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018461 Missense 134 406 5 12
ENSDART00000111753 Essential Splice Site 133 149 None 7

The following transcripts of ENSDARG00000012450 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 16369425)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 17414388
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGGCCTGGGTATTTTGTCTTCGGTTGGTCTCGGCACTGGACTACATACG[T/A]TTCTCCTGTACCTGGTAAGAGTTCTTGGCTTAAATTTAGACTTTCTCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10666
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018461 Nonsense 319 406 10 12
ENSDART00000111753   None 149 None 7

The following transcripts of ENSDARG00000012450 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 16384268)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 17429231
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTGCAGAAACTGTTTGTTATCATTACGTTCAGCAAGCACATAGTGGAG[C/T]AGATGGTGTCTCTGATCGGGTGAGTAACAATGGACAGACAGTGCTAAACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link