si:ch211-169p10.1

Ensembl ID:
ENSDARG00000012449
ZFIN ID:
ZDB-GENE-081104-59
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0S599]
Human Orthologue:
CCDC120
Human Description:
coiled-coil domain containing 120 [Source:HGNC Symbol;Acc:28910]
Mouse Orthologue:
Ccdc120
Mouse Description:
coiled-coil domain containing 120 Gene [Source:MGI Symbol;Acc:MGI:1859619]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41120 Essential Splice Site Mutation detected in F1 DNA During 2017
sa21197 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41120
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022469 Essential Splice Site 94 601 3 9
ENSDART00000137920 Essential Splice Site 94 601 5 11
Genomic Location (Zv9):
Chromosome 8 (position 8565545)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 7982127
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGGCTGGTCTTTCCCGCAGCAGCTCCAAACATAACACGAAAAATGAG[G/A]TGTGCAGACTTGTTTGAAGAATAAGAGTGGACACTGATTTAATATTGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21197
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022469 Nonsense 120 601 4 9
ENSDART00000137920 Nonsense 120 601 6 11
Genomic Location (Zv9):
Chromosome 8 (position 8565714)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 7982296
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAGAAAACCCTGTTCAGCGGCGCCCTCCGCAGGCACACCGATGCAGAA[C/T]AGCATCCACAGCACAGCAAACGCACGGTTCATAGAGGATGCCACACAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link