efemp2

Ensembl ID:
ENSDARG00000012437
ZFIN ID:
ZDB-GENE-041212-8
Description:
EGF-containing fibulin-like extracellular matrix protein 2 [Source:RefSeq peptide;Acc:NP_001008587]
Human Orthologue:
EFEMP2
Human Description:
EGF-containing fibulin-like extracellular matrix protein 2 [Source:HGNC Symbol;Acc:3219]
Mouse Orthologue:
Efemp2
Mouse Description:
epidermal growth factor-containing fibulin-like extracellular matrix protein 2 Gene [Source:MGI Symb

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42407 Nonsense Mutation detected in F1 DNA During 2016
sa1694 Essential Splice Site Available for shipment Available now
sa15681 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42407
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028849 Nonsense 23 440 2 11

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 31563474)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 30353531
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGCTCTTTTGTATGTGCATCTCTGTGTTTCTCCACCGCGCTATTTCA[C/T]AGCCACCCACAGAAACTGACACCTACACGGTAAGGAGGAACGAAACCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1694
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028849 Essential Splice Site 32 440 2 11

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 31563443)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 30353500
KASP Assay ID:
554-1640.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCCACCGCGCTATTTCACAGCCACCCACAGAAACTGACACCTACACGG[T/A]AAGGAGGAACGAAACCTTCCCCTGYYTCTCGCTACACTTTCTTTATCTTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa15681
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028849 Essential Splice Site 33 440 None 11

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 31563297)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 30353354
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGTAMTCAGGCTACATCTACAGWGTTTACTTATTCATGTGTATTTTAT[A/T]GGAATGTACAGATGGATATCACTGGGATTCACAGACTCAGCACTGCAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link