fam76b

Ensembl ID:
ENSDARG00000012432
ZFIN ID:
ZDB-GENE-030131-6955
Description:
Protein FAM76B [Source:UniProtKB/Swiss-Prot;Acc:Q6PBM7]
Human Orthologue:
FAM76B
Human Description:
family with sequence similarity 76, member B [Source:HGNC Symbol;Acc:28492]
Mouse Orthologue:
Fam76b
Mouse Description:
family with sequence similarity 76, member B Gene [Source:MGI Symbol;Acc:MGI:1920076]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20397 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20397
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024815 Nonsense 62 328 3 10
Genomic Location:
Chromosome 5 (position 25261288)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCTTTCCTTTCGTTCAGCAAAACCAACACTATCTGTAAGAAATGCGCA[C/T]AGAATGTCAAACAGTTTGGAACAGTAAGTTGACATCATGTTTAAAAAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5jxjxvff