nefl

Ensembl ID:
ENSDARG00000012426
ZFIN ID:
ZDB-GENE-060312-44
Description:
neurofilament, light polypeptide [Source:RefSeq peptide;Acc:NP_001034927]
Mouse Orthologue:
Nefl
Mouse Description:
neurofilament, light polypeptide Gene [Source:MGI Symbol;Acc:MGI:97313]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34292 Nonsense Available for shipment Available now
sa13719 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34292
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005321 Nonsense 120 579 1 4
ENSDART00000101454 Nonsense 57 437 1 5
Genomic Location (Zv9):
Chromosome 8 (position 7446611)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 6833414
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTGGAGCTCCAAAATCGTGCACTGGAGTCAGAGCTGCTCTTGCTGCGC[C/T]AGAGGCACTGTGAACCTTCCCGACTCCGGGGTCTGTATGAACAAGAGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13719
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005321 Nonsense 134 579 1 4
ENSDART00000101454 Nonsense 71 437 1 5
Genomic Location (Zv9):
Chromosome 8 (position 7446569)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 6833372
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTGCGCCAGAGGCACTGTGAACCTTCCMGACTCMGGGGTCTGTATGAA[C/T]AAGARGCAAGGGAACTTCGTGCGGCGGTAGATGAGGCCCGCAGGGAGCGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link