col11a2

Ensembl ID:
ENSDARG00000012422
ZFIN ID:
ZDB-GENE-000208-23
Description:
collagen alpha-2(XI) chain [Source:RefSeq peptide;Acc:NP_001073461]
Human Orthologue:
COL11A2
Human Description:
collagen, type XI, alpha 2 [Source:HGNC Symbol;Acc:2187]
Mouse Orthologue:
Col11a2
Mouse Description:
collagen, type XI, alpha 2 Gene [Source:MGI Symbol;Acc:MGI:88447]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17390 Nonsense Available for shipment Available now
sa18324 Nonsense Available for shipment Available now
sa23437 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17390
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033363 Nonsense 206 1695 5 65
ENSDART00000104799 Nonsense 206 1877 5 64
ENSDART00000105754 Nonsense 206 2021 4 65
ENSDART00000128331 Nonsense 206 427 5 7
ENSDART00000133179 Nonsense 207 1722 4 63
Genomic Location:
Chromosome 19 (position 7836094)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCARGGGCATCACWGTTTTTGGAGCCCGTCTCCTGGATGAGGAGGTTTWC[C/T]AGGTCTGCTTTAGCAACRAGTGCAAWGAGTTAGAAATTGTGTGGTGCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18324
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033363 Nonsense 228 1695 6 65
ENSDART00000104799 Nonsense 228 1877 6 64
ENSDART00000105754 Nonsense 228 2021 5 65
ENSDART00000128331 Nonsense 228 427 6 7
ENSDART00000133179 Nonsense 229 1722 5 63
Genomic Location:
Chromosome 19 (position 7834334)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGYTGATCGCAWCCAACCCTCAGGCCGCATATGACTTCTGTGAGCATTA[C/A]AGCCCKGACTGCGACTCTCCTCTGCCCAAARTCCAGTCCCAGGACCCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23437
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033363 Nonsense 1402 1695 60 65
ENSDART00000104799 Nonsense 1584 1877 59 64
ENSDART00000105754 Nonsense 1728 2021 60 65
ENSDART00000128331 None None 427 None 7
ENSDART00000133179 Nonsense 1429 1722 58 63
Genomic Location:
Chromosome 19 (position 7808575)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCAAATTCTCTTTATCTTATCTCTGTGGTACAGGGTGGGGCTGGTCCT[A/T]AAGGAGAAAAGGGTGTACAAGGACCACCAGGACCACCTGTGAGTTGAAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rk78zh1f