rnf207

Ensembl ID:
ENSDARG00000012409
ZFIN ID:
ZDB-GENE-080227-9
Human Orthologue:
RNF207
Human Description:
ring finger protein 207 [Source:HGNC Symbol;Acc:32947]
Mouse Orthologue:
Rnf207
Mouse Description:
ring finger protein 207 Gene [Source:MGI Symbol;Acc:MGI:2684989]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17871 Nonsense Available for shipment Available now
sa9730 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17871
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077945 Nonsense 280 634 8 17
ENSDART00000142000 Nonsense 280 634 9 18

The following transcripts of ENSDARG00000012409 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 21801061)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTATTTTTTAGTCAGCATGAAGAGAAGGAGAGAACCTTTAAAGAGCAAT[T/A]ATCTCAWCTTGCTGCACTCCTGCCAACTCTCCAGGTAARTACATTTCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9730
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077945 Essential Splice Site 556 634 15 17
ENSDART00000142000 Essential Splice Site 556 634 16 18

The following transcripts of ENSDARG00000012409 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 21795064)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GKTCCCTACATCCGCTCWATAGCAAAAGTGAAGGAACGTCTGGAGCCAAG[G/A]TACTAGAGAGCTTGATTTATAAGTTTCATGGCTTATAAAGTTTCATGGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • QT interval: Common variants at ten loci influence QT interval duration in the QTGEN Study. (View Study)
  • QT interval: Common variants at ten loci modulate the QT interval duration in the QTSCD Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6pgpcvmn