col1a1a

Ensembl ID:
ENSDARG00000012405
ZFIN ID:
ZDB-GENE-030131-9102
Description:
collagen alpha-1(I) chain [Source:RefSeq peptide;Acc:NP_954684]
Human Orthologue:
COL1A1
Human Description:
collagen, type I, alpha 1 [Source:HGNC Symbol;Acc:2197]
Mouse Orthologue:
Col1a1
Mouse Description:
collagen, type I, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88467]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3437 Essential Splice Site Mutation detected in F1 DNA During 2014
sa25246 Essential Splice Site Mutation detected in F1 DNA During 2014
sa1748 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3437
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009393 Essential Splice Site 198 1447 8 51
ENSDART00000047010 Essential Splice Site 198 1366 8 52

The following transcripts of ENSDARG00000012405 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 23516428)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAGGATTTACTGGTCCCCCTGGCGAGCCTGGTGAGGCTGGTGCTCCTG[T/C]GAGTATCTAAATTAGTTATCTGCAAACTCATCAACCCTGCTTCATTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25246
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009393 Essential Splice Site 693 1447 31 51
ENSDART00000047010 Essential Splice Site 693 1366 31 52

The following transcripts of ENSDARG00000012405 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 23522794)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTTGGTGCCCGTGGTTCTCCTGGTTCAGCTGGTAACGATGGTGCCAAG[G/A]TAAGTCTCATCTCTTCTGACTATTTTTATCATGCCAGACATTTACAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1748
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009393 Nonsense 1179 1447 48 51
ENSDART00000047010 Nonsense 1179 1366 48 52

The following transcripts of ENSDARG00000012405 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 23526433)
KASP Assay ID:
554-1741.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCTCCTGGACCTCCCGGCCCCCCTGGAGCACCTGGACCCTCTGGTGGT[G/T]GATTCGAYATTGGCTTCATTGCCCAGCCACAGGAGAAGGCCCCTGATCCC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Prostate cancer: A genome-wide association study of breast and prostate cancer in the NHLBI's Framingham Heart Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bn911rsl