A2RUZ9_DANRE

Ensembl ID:
ENSDARG00000012403
Description:
LOC553504 protein [Source:UniProtKB/TrEMBL;Acc:A2RUZ9]
Human Orthologue:
C9orf102
Human Description:
chromosome 9 open reading frame 102 [Source:HGNC Symbol;Acc:26922]
Mouse Orthologue:
0610007P08Rik
Mouse Description:
RIKEN cDNA 0610007P08 gene Gene [Source:MGI Symbol;Acc:MGI:1923501]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41233 Nonsense Mutation detected in F1 DNA During 2016
sa9243 Essential Splice Site Mutation detected in F1 DNA During 2016
sa25397 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa41233
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061993 Nonsense 64 1105 4 20
ENSDART00000122774 Nonsense 66 1269 1 17
ENSDART00000125173 Nonsense 64 1100 3 19
Genomic Location (Zv9):
Chromosome 8 (position 30774771)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 29917497
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTAAAAGTTCCGTACACCATCAATCGGTATTTACGGGACTACCAGCGA[G/T]AAGGCATTAAATTCATCTATCAAAACTATGCCAAATCCAGAGGATGCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9243
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061993 Essential Splice Site 92 1105 None 20
ENSDART00000122774 Essential Splice Site 94 1269 None 17
ENSDART00000125173 Essential Splice Site 92 1100 None 19
Genomic Location (Zv9):
Chromosome 8 (position 30774683)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 29917409
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGGATGCATCTTGGGTGATGATATGGGGCTTGGAAAGACTGTTCAGG[T/G]WAAAGCACACACATTTTTSTAAAGAGTATACATAGTAAAGACTGCTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25397
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061993 Nonsense 121 1105 5 20
ENSDART00000122774 Nonsense 123 1269 2 17
ENSDART00000125173 Nonsense 121 1100 4 19
Genomic Location (Zv9):
Chromosome 8 (position 30774522)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 29917248
KASP Assay ID:
554-7519.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGGTACATGGAAAGATGTTGAGAACAACAGGCCTCAGTTTTTGCTGTCA[C/T]AAAAACCATCAGAACGAGTTCAGAAGGTGACACATGCTTTTTAGTCAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link