adssl

Ensembl ID:
ENSDARG00000012399
ZFIN ID:
ZDB-GENE-020419-28
Description:
adenylosuccinate synthase, like [Source:RefSeq peptide;Acc:NP_775344]
Human Orthologues:
ADSS, ADSSL1
Human Descriptions:
adenylosuccinate synthase like 1 [Source:HGNC Symbol;Acc:20093]
adenylosuccinate synthase [Source:HGNC Symbol;Acc:292]
Mouse Orthologues:
Adss, Adssl1
Mouse Descriptions:
adenylosuccinate synthetase like 1 Gene [Source:MGI Symbol;Acc:MGI:87947]
adenylosuccinate synthetase, non muscle Gene [Source:MGI Symbol;Acc:MGI:87948]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6675 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa6675
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016819 Essential Splice Site 363 462 10 13
ENSDART00000134617 Essential Splice Site 369 468 10 13

The following transcripts of ENSDARG00000012399 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 25921595)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 26491413
KASP Assay ID:
554-5059.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGATCTGGTTTTGGTTCGCTATGCCCACATGGTWAACGGGTTTTCAGCG[T/C]AAGTTGTGTTGAGTGTTTTACATGTGCTTTCATTCAAACATTTGGCYAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link