eya4

Ensembl ID:
ENSDARG00000012397
ZFIN ID:
ZDB-GENE-050327-93
Description:
eyes absent 4 [Source:RefSeq peptide;Acc:NP_001014387]
Human Orthologue:
EYA4
Human Description:
eyes absent homolog 4 (Drosophila) [Source:HGNC Symbol;Acc:3522]
Mouse Orthologue:
Eya4
Mouse Description:
eyes absent 4 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1337104]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13475 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13475
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045433 Essential Splice Site None 248 10 20
ENSDART00000126920 Essential Splice Site 318 634 10 19
ENSDART00000131352 Essential Splice Site 297 613 9 18
ENSDART00000133002 Essential Splice Site 320 636 10 19
ENSDART00000138625 Essential Splice Site 320 636 10 19
ENSDART00000143425 Essential Splice Site 297 613 10 19
Genomic Location:
Chromosome 23 (position 31702241)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGCTGCAGGACCCCATCATGACAGGGCAAGCAGCTGACCTGAATCCAG[G/A]TAAACGGCGAACAGTTTCAGWGTTTCTCTTTWCAWTTAARCTTAAAAACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xhsglugk