mmp13a

Ensembl ID:
ENSDARG00000012395
ZFIN IDs:
ZDB-GENE-031202-2, ZDB-GENE-031202-2, ZDB-GENE-031202-2
Description:
matrix metalloproteinase 13a [Source:RefSeq peptide;Acc:NP_958911]
Human Orthologues:
MMP1, MMP27, MMP8
Human Descriptions:
matrix metallopeptidase 1 (interstitial collagenase) [Source:HGNC Symbol;Acc:7155]
matrix metallopeptidase 27 [Source:HGNC Symbol;Acc:14250]
matrix metallopeptidase 8 (neutrophil collagenase) [Source:HGNC Symbol;Acc:7175]
Mouse Orthologues:
Mmp12, Mmp1a, Mmp1b, Mmp27, Mmp8
Mouse Descriptions:
matrix metallopeptidase 12 Gene [Source:MGI Symbol;Acc:MGI:97005]
matrix metallopeptidase 1a (interstitial collagenase) Gene [Source:MGI Symbol;Acc:MGI:1933846]
matrix metallopeptidase 1b (interstitial collagenase) Gene [Source:MGI Symbol;Acc:MGI:1933847]
matrix metallopeptidase 27 Gene [Source:MGI Symbol;Acc:MGI:3039232]
matrix metallopeptidase 8 Gene [Source:MGI Symbol;Acc:MGI:1202395]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41716 Nonsense Mutation detected in F1 DNA During 2017
sa34965 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41716
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005436   None 169 None 11
ENSDART00000011573 Nonsense 344 476 7 10
ENSDART00000126444 Nonsense 344 476 7 11
Genomic Location (Zv9):
Chromosome 10 (position 39965320)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 38655291
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATTCAAAGCTTCTGGCCTGAGATTCCAGATAACATCGATGCCGCTTTC[G/T]AGAGTGTCATCCAGGACAAAGTCTTCCTGATCAAAGGTAAAAAACACAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34965
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005436   None 169 None 11
ENSDART00000011573   None 476 None 10
ENSDART00000126444 Nonsense 373 476 8 11
Genomic Location (Zv9):
Chromosome 10 (position 39968139)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 38658110
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAGAAGGTTTGGGCTCTCTATGGCTATGATATTGTGCAAGGCTATCCC[A/T]AGAGTCTCAGCATGTTCCGTCTGCGGAAAAATGTGAAGAAAATCGACGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link