adar

Ensembl ID:
ENSDARG00000012389
ZFIN ID:
ZDB-GENE-000616-5
Description:
double-stranded RNA-specific adenosine deaminase [Source:RefSeq peptide;Acc:NP_571671]
Human Orthologue:
ADAR
Human Description:
adenosine deaminase, RNA-specific [Source:HGNC Symbol;Acc:225]
Mouse Orthologue:
Adar
Mouse Description:
adenosine deaminase, RNA-specific Gene [Source:MGI Symbol;Acc:MGI:1889575]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16847 Nonsense Available for shipment Available now
sa18476 Nonsense Available for shipment Available now
sa22832 Nonsense Mutation detected in F1 DNA During 2014
sa6428 Nonsense Mutation detected in F1 DNA During 2014
sa817 Nonsense Available for shipment Available now
sa19141 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16847
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025629 Nonsense 114 1373 1 15
ENSDART00000103213 Nonsense 114 916 2 16
ENSDART00000130112 Nonsense 114 1380 2 17
ENSDART00000146708 Nonsense 114 1381 2 15
Genomic Location:
Chromosome 16 (position 25775541)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTAAGCTTCCGACAAAACCAGGTGCAGTTCCTCAGGGGGCAGAGTGCA[C/T]AAGCTCCTCAGTTCAAAGCACCCCAGYCGCGAGGGTCCCAAAGCTCTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18476
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025629 Nonsense 164 1373 1 15
ENSDART00000103213 Nonsense 164 916 2 16
ENSDART00000130112 Nonsense 164 1380 2 17
ENSDART00000146708 Nonsense 164 1381 2 15
Genomic Location:
Chromosome 16 (position 25775691)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGACTTTAAATCAAACAGTTACAGTTTTGGAAGAAGAAACTGTTACGGC[A/T]GAGGACAGGATAACTGGCAAGGGGAGCAGAATTTTGGACCTAAAAAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22832
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025629 Nonsense 193 1373 1 15
ENSDART00000103213 Nonsense 193 916 2 16
ENSDART00000130112 Nonsense 193 1380 2 17
ENSDART00000146708 Nonsense 193 1381 2 15
Genomic Location:
Chromosome 16 (position 25775780)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTAAAAAAAGGTCAGGGTGGAATCACCCACACCAGAAGGGACAATATTA[T/G]TCAAATCAGCACTATAAACAATTCTGGAACGCTCGGGCAAATGATTTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6428
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025629 Nonsense 545 1373 1 15
ENSDART00000103213 Nonsense 545 916 2 16
ENSDART00000130112 Nonsense 545 1380 2 17
ENSDART00000146708 Nonsense 545 1381 2 15
Genomic Location:
Chromosome 16 (position 25776835)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTAGACAATGACAATGTTTTTGGTAACACAGAAATTGACATTCCTGGCT[T/G]AGAACCGGTATCCAAAGCAAGTGACCTTTCCTCCTCAACCCATCGGAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa817
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025629 Nonsense 992 1373 8 15
ENSDART00000103213 None None 916 9 16
ENSDART00000130112 Nonsense 999 1380 10 17
ENSDART00000146708 Nonsense 1000 1381 8 15
Genomic Location:
Chromosome 16 (position 25787935)
KASP Assay ID:
554-0721.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAGAAAAATTCTTGCAACTATTGTGATGCGCAATGGAACGGACAGTCTT[G/T]GAAAAGTTGTCAGCCTCGGGACAGGTACAAATACACACACAGACTCGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19141
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025629 Essential Splice Site 1000 1373 9 15
ENSDART00000103213 Essential Splice Site None 916 10 16
ENSDART00000130112 Essential Splice Site 1007 1380 11 17
ENSDART00000146708 Essential Splice Site 1008 1381 9 15
Genomic Location:
Chromosome 16 (position 25788052)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCACTGTAATTAAAGAAGTGCTGTAATTGTTCTTGTCTGATGTCTCTA[G/T]GAAACCGCTGTGTTAAAGGAGAGGAGCTCAGTCTTCGTGGGGACACTGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bkzh0aki