pdha1a

Ensembl ID:
ENSDARG00000012387
ZFIN ID:
ZDB-GENE-040426-2719
Description:
pyruvate dehydrogenase E1 alpha 1 [Source:RefSeq peptide;Acc:NP_998558]
Human Orthologues:
PDHA1, PDHA2
Human Descriptions:
pyruvate dehydrogenase (lipoamide) alpha 1 [Source:HGNC Symbol;Acc:8806]
pyruvate dehydrogenase (lipoamide) alpha 2 [Source:HGNC Symbol;Acc:8807]
Mouse Orthologues:
Pdha1, Pdha2
Mouse Descriptions:
pyruvate dehydrogenase E1 alpha 1 Gene [Source:MGI Symbol;Acc:MGI:97532]
pyruvate dehydrogenase E1 alpha 2 Gene [Source:MGI Symbol;Acc:MGI:97533]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20403 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20403
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023784 Nonsense 69 393 3 11
Genomic Location (Zv9):
Chromosome 5 (position 25708478)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23535743
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCAGCAGTGCAGGCAGTGCTAACCAGAGAAGAAGGCCTTCAATACTAC[C/T]GAACAATGCAGACCATGAGGCGCATGGAGCTCAAAGCTGATCAGCTGTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link