naa35

Ensembl ID:
ENSDARG00000012378
ZFIN ID:
ZDB-GENE-030131-306
Description:
N-alpha-acetyltransferase 35, NatC auxiliary subunit [Source:UniProtKB/Swiss-Prot;Acc:Q7T322]
Human Orthologue:
NAA35
Human Description:
N(alpha)-acetyltransferase 35, NatC auxiliary subunit [Source:HGNC Symbol;Acc:24340]
Mouse Orthologue:
Naa35
Mouse Description:
N(alpha)-acetyltransferase 35, NatC auxiliary subunit Gene [Source:MGI Symbol;Acc:MGI:1925939]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12739 Essential Splice Site Available for shipment Available now
sa31684 Essential Splice Site Available for shipment Available now
sa10722 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12739
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098707 Essential Splice Site 208 724 8 23
Genomic Location (Zv9):
Chromosome 8 (position 52211481)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49960333
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTAGGAATGCTGAAAGATGTTGAGGATGAACTTCAGAGGAAAGTRAAGG[T/A]ATGAGGACTCRAATKKAAACATTATTTAGTTGATTCTTYGATTATTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31684
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098707 Essential Splice Site 637 724 20 23
Genomic Location (Zv9):
Chromosome 8 (position 52227231)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49976083
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCAACAGTGTGGTCACGCCACCACCAGTTCACTACATCCAGTTTAAGG[T/C]ACATGACTTTTATTCAATATACGAAGGGGATGTGTACTGATACAATTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10722
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098707 Essential Splice Site 705 724 22 23
Genomic Location (Zv9):
Chromosome 8 (position 52229510)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49978362
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTGTTGTAATGAAGCTGCTGGCTGGAGGACACAAGAAGGAGACCAAGG[T/C]ACNAAAAAATGTWTTWTGGTTATGTCCCTTGTTACAAGATGTAAWRTAACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link