rdh10b

Ensembl ID:
ENSDARG00000012369
ZFIN ID:
ZDB-GENE-030909-7
Description:
Retinol dehydrogenase 10-B [Source:UniProtKB/Swiss-Prot;Acc:Q7T2D1]
Human Orthologue:
RDH10
Human Description:
retinol dehydrogenase 10 (all-trans) [Source:HGNC Symbol;Acc:19975]
Mouse Orthologue:
Rdh10
Mouse Description:
retinol dehydrogenase 10 (all-trans) Gene [Source:MGI Symbol;Acc:MGI:1924238]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38337 Nonsense Mutation detected in F1 DNA During 2017
sa25824 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38337
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004903 Nonsense 108 336 2 6
ENSDART00000129759 Nonsense 113 342 3 7
Genomic Location (Zv9):
Chromosome 2 (position 29898544)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30200179
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGTCTTCAGATAGTGTTCAGGAATTGCCTCTTCTCCAGCCGAAGGTTTA[C/A]ACGTATATGTGTGATGTCAGTAAACGTGAGAGTGTGTATTTGACTGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25824
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004903 Nonsense 270 336 5 6
ENSDART00000129759 Nonsense 276 342 6 7
Genomic Location (Zv9):
Chromosome 2 (position 29900098)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30201733
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAATGGCTCCATTTTTCCCTCCACTGAAGCCAGAGTACTGTGTAAAA[C/T]AGGCTATGAGAGCCATACTAACAGACCAGCCAATGATCTGCACCCCTCGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link