LOC569905

Ensembl ID:
ENSDARG00000012367
Human Orthologue:
TRIM46
Human Description:
tripartite motif-containing 46 [Source:HGNC Symbol;Acc:19019]
Mouse Orthologue:
Trim46
Mouse Description:
tripartite motif-containing 46 Gene [Source:MGI Symbol;Acc:MGI:2673000]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22830 Essential Splice Site Mutation detected in F1 DNA During 2014
sa6427 Nonsense Mutation detected in F1 DNA During 2014
sa22829 Nonsense Mutation detected in F1 DNA During 2014
sa10027 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22830
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045891 Essential Splice Site 106 773 3 12
Genomic Location:
Chromosome 16 (position 25610397)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAAACAGCTTCTGCTATCTGTATCTCTCTCTTTCTCTGTTTTTGTGCA[G/A]TGTGCGGAACTCATCCGGGACGCAGGCGTAAAGACACCCCTCCTATACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6427
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045891 Nonsense 188 773 4 12
Genomic Location:
Chromosome 16 (position 25605996)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGCAAACCTCCTCAGACTCTGGAAGCCACTAAAGGTTGCGCCGACTG[C/A]AGGTCCAACTTCTGCAATGAGTGCTTCAAACTGTACCACCCGTGGGGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22829
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045891 Nonsense 321 773 7 12
Genomic Location:
Chromosome 16 (position 25601332)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAACAGTGCGGTGGTGAAGGAGCAGTTGTCTCAGTGTGTGAATGAGCTG[C/T]GAGCTGTGCTGGCCGAGCGTCAGGGGGCTTTGGCTATGTGTCTGGAAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10027
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045891 Nonsense 765 773 12 12
Genomic Location:
Chromosome 16 (position 25592863)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATAGCCAATCGCAGCACAGAGCAGAACCCACCAAGAAGAGTGACTATC[C/T]AAACACGRGTCACAGACGCAGGTCACTAAAACATCTGATCGCTCTGAAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Urate levels: Genome-wide association analyses identify 18 new loci associated with serum urate concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2p0a9dyi