galnt8a

Ensembl ID:
ENSDARG00000012355
ZFIN ID:
ZDB-GENE-091015-4
Human Orthologue:
GALNT8
Human Description:
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8) [Sour

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30227 Nonsense Mutation detected in F1 DNA During 2017
sa24636 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30227
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025186 Nonsense 352 556 7 11
Genomic Location (Zv9):
Chromosome 25 (position 17094819)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16641363
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAAAGAGCACATAAGCCTTATTCACCAGATCTCAGCAAACCCATGATC[C/T]GAAACGCATTGAGAGTGGCTGAAATCTGGATGGATGAATATAAATCCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24636
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025186 Nonsense 453 556 9 11
Genomic Location (Zv9):
Chromosome 25 (position 17094316)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16640860
KASP Assay ID:
2261-9523.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGGACCTGTTCCTGGAAGTGTGCCTATTCTCTACGGATGTCATTACTA[T/G]GAGCCTCAGGTATACTGTATATGTATATTTTACTGTGTGTAAGGAATAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link