nacad

Ensembl ID:
ENSDARG00000012347
ZFIN ID:
ZDB-GENE-091020-7
Human Orthologue:
NACAD
Human Description:
NAC alpha domain containing [Source:HGNC Symbol;Acc:22196]
Mouse Orthologue:
Nacad
Mouse Description:
NAC alpha domain containing Gene [Source:MGI Symbol;Acc:MGI:3603030]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5894 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa5894
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019658 Nonsense 1241 1870 2 9
Genomic Location (Zv9):
Chromosome 16 (position 29858609)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 27695747
KASP Assay ID:
554-3937.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCATAAAGAGACATCAAATTCCAATGAYGTTGTGGGGGAGAAAGTAATT[C/T]AATTAATACCGAACATCAAAAATGAAACAGCAAGTGGTGAAKCTAAAAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link