capn9

Ensembl ID:
ENSDARG00000012341
ZFIN ID:
ZDB-GENE-010724-2
Description:
calpain-9 [Source:RefSeq peptide;Acc:NP_001003501]
Human Orthologue:
CAPN9
Human Description:
calpain 9 [Source:HGNC Symbol;Acc:1486]
Mouse Orthologue:
Capn9
Mouse Description:
calpain 9 Gene [Source:MGI Symbol;Acc:MGI:1920897]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25682 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39702 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25682
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007732 Essential Splice Site 505 688 13 20
Genomic Location (Zv9):
Chromosome 1 (position 54457788)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 53231291
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACTGCTCCTAAAGTTACCTGTATGTATGTTTGTGTCTACTTTTTGAA[G/A]CCACCGAAACCAAACCCACCTGAAGAGGAGACTGATGAGGAGAAAGGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39702
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007732 Nonsense 583 688 16 20
Genomic Location (Zv9):
Chromosome 1 (position 54454471)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 53227974
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCCTGAACTGAGTATAGGTGGATGGATCAGGAATGATGGAATTTTCC[G/T]AGTTCAAAGTCTTCTGGGATAAACTCAAGAAGTGGATCGTAAGTTACAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Myopia (pathological): A genome-wide association study provides evidence for association of chromosome 8p23 (MYP10) and 10q21.1 (MYP15) with high myopia in the French Population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link