cog6

Ensembl ID:
ENSDARG00000012336
ZFIN ID:
ZDB-GENE-040426-909
Description:
component of oligomeric golgi complex 6 [Source:RefSeq peptide;Acc:NP_956614]
Human Orthologue:
COG6
Human Description:
component of oligomeric golgi complex 6 [Source:HGNC Symbol;Acc:18621]
Mouse Orthologue:
Cog6
Mouse Description:
component of oligomeric golgi complex 6 Gene [Source:MGI Symbol;Acc:MGI:1914792]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36028 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36028
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102067   None 170 7 14
ENSDART00000126907 Nonsense 319 656 11 21
ENSDART00000146626   None 77 None 2
Genomic Location (Zv9):
Chromosome 16 (position 6186432)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 3501055
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTGGGGACATGTTGGCCTGGCTCCACCAAGCCACAGCTTCAGAGAAG[G/T]AGCACCTGGAAGCCCTGCTCAAACAAGTGACTGTGCAGGGTAAATGTCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Psoriasis: A genome-wide association study of psoriasis and psoriatic arthritis identifies new disease loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link