usp25

Ensembl ID:
ENSDARG00000012314
ZFIN ID:
ZDB-GENE-040426-2847
Description:
ubiquitin carboxyl-terminal hydrolase 25 [Source:RefSeq peptide;Acc:NP_001001886]
Human Orthologue:
USP25
Human Description:
ubiquitin specific peptidase 25 [Source:HGNC Symbol;Acc:12624]
Mouse Orthologue:
Usp25
Mouse Description:
ubiquitin specific peptidase 25 Gene [Source:MGI Symbol;Acc:MGI:1353655]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16746 Nonsense Available for shipment Available now
sa21787 Nonsense Mutation detected in F1 DNA During 2014
sa11988 Essential Splice Site Available for shipment Available now
sa18443 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16746
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115250 Nonsense 404 1073 12 24
Genomic Location:
Chromosome 10 (position 39575539)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATACTTCCAGTTTTCAGAGAAGCCGCGTGTTGCWTGATTGATTTTNAGGTA[C/A]ATGGACAGGAACCGAGAGATCACACGGATAAAGCGAGAGGAGATCAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21787
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115250 Nonsense 705 1073 17 24
Genomic Location:
Chromosome 10 (position 39562530)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTTGTGGAGGCAGATAACAAGCTCTTCGAGAGGGAGATGGAGGAGTG[G/A]GATGCTTTACAGGCCCGCAAACTCCAGCAGGAAAAGTTGGCTCTGGCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11988
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115250 Essential Splice Site 908 1073 21 24
Genomic Location:
Chromosome 10 (position 39544616)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGACGTCAGTGTTCCTGTTGATCGGCCTGGAATTATTYATGAAGAAAAG[G/A]TGAAGATCCATTTCTTGCATTTCAAGTTCACAGTTATGTATGCAAACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18443
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115250 Nonsense 954 1073 23 24
Genomic Location:
Chromosome 10 (position 39539675)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AYTGATYTTTCTGTGTTGTTTTCGTGTGTGCTGTAGAAGTTAAATGARTA[C/A]GCTGCCGCTTTGTTCGAGACKGGCGAGGAGGCTAAAGTGAACACGGGTCW
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Panic disorder: Genome-wide association study of panic disorder in the Japanese population. (View Study)
  • Parkinson's disease: Web-based genome-wide association study identifies two novel loci and a substantial genetic component for Parkinson's disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rt9dcl85