myoz2

Ensembl ID:
ENSDARG00000012311
ZFIN IDs:
ZDB-GENE-040426-1880, ZDB-GENE-040426-1880
Description:
myozenin 2 [Source:RefSeq peptide;Acc:NP_957193]
Human Orthologue:
MYOZ2
Human Description:
myozenin 2 [Source:HGNC Symbol;Acc:1330]
Mouse Orthologue:
Myoz2
Mouse Description:
myozenin 2 Gene [Source:MGI Symbol;Acc:MGI:1913063]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14169 Nonsense Available for shipment Available now
sa1608 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14169
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049928 Nonsense 21 264 2 6
ENSDART00000124764 Nonsense 21 264 2 7
ENSDART00000049928 Nonsense 21 264 2 6
ENSDART00000124764 Nonsense 21 264 2 7
Genomic Location:
Chromosome 7 (position 72557209)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAGTCTGATGTCAACACAGGAGAGGAAAATGCAGGCAGCGGCTATTTGT[A/T]GAGAGATCCACGCCAAYGAWGGTACAAACACTGATTTATTACCATTGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1608
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049928 Nonsense 21 264 2 6
ENSDART00000124764 Nonsense 21 264 2 7
ENSDART00000049928 Nonsense 21 264 2 6
ENSDART00000124764 Nonsense 21 264 2 7
Genomic Location:
Chromosome 7 (position 72557209)
KASP Assay ID:
554-1549.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAGTCTGATGTCAACACAGGAGAGGAAAATGCAGGCAGCGGCTATTTGT[A/T]GAGAGATCCACGCCAACGAAGGTACAAACACTGATTTATTACCATTGAGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wzezrrg2