myoz2

Ensembl ID:
ENSDARG00000012311
ZFIN IDs:
ZDB-GENE-040426-1880, ZDB-GENE-040426-1880
Description:
myozenin 2 [Source:RefSeq peptide;Acc:NP_957193]
Human Orthologue:
MYOZ2
Human Description:
myozenin 2 [Source:HGNC Symbol;Acc:1330]
Mouse Orthologue:
Myoz2
Mouse Description:
myozenin 2 Gene [Source:MGI Symbol;Acc:MGI:1913063]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14169 Nonsense Available for shipment Available now
sa1608 Nonsense Available for shipment Available now
sa31620 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14169
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049928 Nonsense 21 264 2 6
ENSDART00000124764 Nonsense 21 264 2 7
ENSDART00000049928 Nonsense 21 264 2 6
ENSDART00000124764 Nonsense 21 264 2 7
Genomic Location:
Chromosome 7 (position 72557209)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAGTCTGATGTCAACACAGGAGAGGAAAATGCAGGCAGCGGCTATTTGT[A/T]GAGAGATCCACGCCAAYGAWGGTACAAACACTGATTTATTACCATTGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1608
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049928 Nonsense 21 264 2 6
ENSDART00000124764 Nonsense 21 264 2 7
ENSDART00000049928 Nonsense 21 264 2 6
ENSDART00000124764 Nonsense 21 264 2 7
Genomic Location:
Chromosome 7 (position 72557209)
KASP Assay ID:
554-1549.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAGTCTGATGTCAACACAGGAGAGGAAAATGCAGGCAGCGGCTATTTGT[A/T]GAGAGATCCACGCCAACGAAGGTACAAACACTGATTTATTACCATTGAGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa31620
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049928 Essential Splice Site 27 264 2 6
ENSDART00000124764 Essential Splice Site 27 264 2 7
Genomic Location:
Chromosome 7 (position 72557187)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGAAAATGCAGGCAGCGGCTATTTGTAGAGAGATCCACGCCAACGAAG[G/A]TACAAACACTGATTTATTACCATTGAGTTGGGCTAGGCAGAATCTGAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link