ap1g1

Ensembl ID:
ENSDARG00000012294
ZFIN ID:
ZDB-GENE-030131-3187
Description:
AP-1 complex subunit gamma-1 [Source:RefSeq peptide;Acc:NP_955976]
Human Orthologue:
AP1G1
Human Description:
adaptor-related protein complex 1, gamma 1 subunit [Source:HGNC Symbol;Acc:555]
Mouse Orthologue:
Ap1g1
Mouse Description:
adaptor protein complex AP-1, gamma 1 subunit Gene [Source:MGI Symbol;Acc:MGI:101919]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12746 Nonsense Available for shipment Available now
sa21138 Nonsense Mutation detected in F1 DNA During 2014
sa13042 Essential Splice Site Available for shipment Available now
sa7103 Nonsense Mutation detected in F1 DNA During 2014
sa25376 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12746
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006455 Nonsense 77 819 2 22
Genomic Location:
Chromosome 7 (position 70430771)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGGACAAAATGTCAATTTCAGCTGGAGTGCCTGAAACTGATTGCATCA[C/T]AGAAGTTCACAGATAAAAGGATAGGATACCTGGGAGCCATGCTGCTTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21138
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006455 Nonsense 221 819 6 22
Genomic Location:
Chromosome 7 (position 70425152)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTCTTTTCTCCCAATTATGTATCTTTTTAGCTGGTTCCACAACTTGTG[C/T]GAATCCTGAAGAACCTGATCATGTCAGGCTACTCTCCTGAGCATGATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13042
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006455 Essential Splice Site 363 819 10 22
Genomic Location:
Chromosome 7 (position 70420150)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGYACTATCGTGGACTGCTTAAAAGACCTTGACGTGTCCATTAAAAGG[T/A]AATTTATGTGCACTCTATGGATATTTATGCATGCCGCGACATCNTCCTMC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7103
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006455 Nonsense 411 819 12 22
Genomic Location:
Chromosome 7 (position 70417748)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTGTTTATTTGGTTTGCTGATGTMACTAATGATTGTTTGTTGCAGGTA[T/A]GCGCCTTCCAAAAGATGGCACATAGACACCATTATGAGGGTTCTGACCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25376
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006455 Nonsense 691 819 19 22
Genomic Location:
Chromosome 7 (position 70407804)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCTGTGCCCATGTCCCAGCCCCCTTTCCTTTTGGACGGTCTCACTTCA[C/T]AGCCCCTCTTCAATGACATTGGAGCGGGTGAGCTTACAGTCAATTTCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/g5e6ti3h