tmem206

Ensembl ID:
ENSDARG00000012271
ZFIN ID:
ZDB-GENE-040426-1173
Description:
Transmembrane protein 206 [Source:UniProtKB/Swiss-Prot;Acc:Q7SY31]
Human Orthologue:
TMEM206
Human Description:
transmembrane protein 206 [Source:HGNC Symbol;Acc:25593]
Mouse Orthologue:
Tmem206
Mouse Description:
transmembrane protein 206 Gene [Source:MGI Symbol;Acc:MGI:1914200]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1880 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1880
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010975 Nonsense 74 298 4 8
ENSDART00000141182 Nonsense 74 181 2 4
Genomic Location:
Chromosome 17 (position 45550359)
KASP Assay ID:
554-1870.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTCTTTTGTTTGCAGGAATTGTTTTATTTCCTGGAAAGGCACATTTAT[T/G]AAGCTGCATGCATCACTATCACGACAACATTCCACCTCTTGTTGCATTGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2p3zvdhz