tmem206

Ensembl ID:
ENSDARG00000012271
ZFIN ID:
ZDB-GENE-040426-1173
Description:
Transmembrane protein 206 [Source:UniProtKB/Swiss-Prot;Acc:Q7SY31]
Human Orthologue:
TMEM206
Human Description:
transmembrane protein 206 [Source:HGNC Symbol;Acc:25593]
Mouse Orthologue:
Tmem206
Mouse Description:
transmembrane protein 206 Gene [Source:MGI Symbol;Acc:MGI:1914200]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1880 Nonsense Available for shipment Available now
sa42999 Nonsense Mutation detected in F1 DNA During 2016
sa42998 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa1880
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010975 Nonsense 74 298 4 8
ENSDART00000141182 Nonsense 74 181 2 4
Genomic Location:
Chromosome 17 (position 45550359)
KASP Assay ID:
554-1870.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTCTTTTGTTTGCAGGAATTGTTTTATTTCCTGGAAAGGCACATTTAT[T/G]AAGCTGCATGCATCACTATCACGACAACATTCCACCTCTTGTTGCATTGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa42999
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010975 Nonsense 80 298 4 8
ENSDART00000141182 Nonsense 80 181 2 4
Genomic Location:
Chromosome 17 (position 45550340)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGTTTTATTTCCTGGAAAGGCACATTTATTAAGCTGCATGCATCACTA[T/A]CACGACAACATTCCACCTCTTGTTGCATTGGAAAATCTTGCGAAAAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42998
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010975 Nonsense 224 298 7 8
ENSDART00000141182   None 181 None 4
Genomic Location:
Chromosome 17 (position 45547322)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTCTAGTCTAGTGTGGTGAAGTACATTGACAAAAGGCCTCCACTGGAG[C/T]AAACCAACGAGCTTTTCTTCATCGTGTTCCAATGGCGGGATCCATTTATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link