cr855317.3

Ensembl ID:
ENSDARG00000012269
ZFIN ID:
ZDB-GENE-100921-11
Human Orthologue:
CLCN1
Human Description:
chloride channel 1, skeletal muscle [Source:HGNC Symbol;Acc:2019]
Mouse Orthologue:
Clcn1
Mouse Description:
chloride channel 1 Gene [Source:MGI Symbol;Acc:MGI:88417]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9118 Nonsense Mutation detected in F1 DNA During 2016
sa22800 Essential Splice Site Available for shipment Available now
sa32083 Nonsense Available for shipment Available now
sa39093 Essential Splice Site Mutation detected in F1 DNA During 2016
sa39092 Nonsense Mutation detected in F1 DNA During 2016
sa13816 Nonsense Available for shipment Available now
sa9348 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa9118
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089292 Nonsense 177 817 5 24
ENSDART00000131328 Nonsense 252 697 6 17
ENSDART00000144994   None 88 None 3
Genomic Location (Zv9):
Chromosome 16 (position 19567527)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17597850
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTGTGCWGCAGTGCTRAGCAGGGTCATGTCAATCTTCACYGGTGTGTA[T/A]GAGGTAAAAATCCCTGTGAGCTTGTTTGGTGTGTGTTGCAGAAGTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22800
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089292 Essential Splice Site 205 817 6 24
ENSDART00000131328 Essential Splice Site 280 697 7 17
ENSDART00000144994   None 88 None 3
Genomic Location (Zv9):
Chromosome 16 (position 19566611)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17596934
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAGGATGTGCTGTTGGGGTGGGCTGCTGTTTTGGGACTCCCCTTGGAGG[T/A]AAAAATTTCCATTTCTTTCTTTCCCCATTGATTTCATTTCCTCTTCTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32083
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089292 Nonsense 207 817 7 24
ENSDART00000131328 Nonsense 282 697 8 17
ENSDART00000144994   None 88 None 3
Genomic Location (Zv9):
Chromosome 16 (position 19563074)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17593397
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTAATCTTTTTTTTTTTTATTCATGTTTTCTCTGTCTCTCAGGTGTGT[T/A]GTTCAGTATTGAGGTCACATCAACATACTTTGCTGTGAGGAATTACTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39093
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089292   414 817 13 24
ENSDART00000131328 Essential Splice Site 488 697 None 17
ENSDART00000144994   None 88 None 3
Genomic Location (Zv9):
Chromosome 16 (position 19556074)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17586397
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATGATTGATAATTGATTGCAATAATATGATAAGATTTTTGAAACAAAC[A/T]GGAGCGGCATTCGGTCGTTTGGTGGGTGAGATCATGGCTACACTTTTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39092
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089292 Nonsense 513 817 14 24
ENSDART00000131328 Nonsense 586 697 15 17
ENSDART00000144994   None 88 None 3
Genomic Location (Zv9):
Chromosome 16 (position 19555656)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17585979
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACAGCCTTCTCTTTATGACTCCATCATTCAGGTCAAAAAGCTGCCATA[T/A]CTTCCAGAGCTCGGCATCGGTCACATCAGGTACCATAAGCAGAGATATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13816
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089292 Nonsense 543 817 15 24
ENSDART00000131328 Nonsense 616 697 16 17
ENSDART00000144994   None 88 None 3
Genomic Location (Zv9):
Chromosome 16 (position 19555350)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17585673
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATCTTTGTGGAGGACATCATGGTGAAGAAAATAAAGTTTCTGTCACCT[C/T]AGTCYACTTACAGAGAGCTRAAAGATCTCCTGGAGTCCACGTCTCTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9348
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089292 Nonsense 765 817 22 24
ENSDART00000131328   None 697 None 17
ENSDART00000144994 Nonsense 50 88 2 3
Genomic Location (Zv9):
Chromosome 16 (position 19540267)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17570590
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTRTTTTAGACTCACACATTGTTCTCTCTACTGGGTCTCAGTCATGCATA[T/A]GTAACCAGTATTGGTAAACTGGTTGGGGTGGTCGCACTAAAGGAGGTAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link