eftud2

Ensembl ID:
ENSDARG00000012261
ZFIN ID:
ZDB-GENE-040426-1569
Description:
116 kDa U5 small nuclear ribonucleoprotein component [Source:RefSeq peptide;Acc:NP_956802]
Human Orthologue:
EFTUD2
Human Description:
elongation factor Tu GTP binding domain containing 2 [Source:HGNC Symbol;Acc:30858]
Mouse Orthologue:
Eftud2
Mouse Description:
elongation factor Tu GTP binding domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1336880]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33122 Nonsense Mutation detected in F1 DNA During 2017
sa40027 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33122
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017172 Nonsense 167 973 7 28
ENSDART00000125268 Nonsense 167 686 7 21
ENSDART00000127309 Nonsense 167 683 7 20
ENSDART00000130575 Nonsense 167 398 7 15
ENSDART00000136465 Nonsense 167 398 7 15
ENSDART00000140067 Nonsense 164 970 6 27
Genomic Location (Zv9):
Chromosome 3 (position 16028142)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 16258361
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCATGTGGTGATGTATTAAAATATTGGTGTTTTCTTCTTTCCACAGTTA[C/T]GATACACAGATATCCTTTTCACTGAGCAAGAGGTAAACTGAAATAGGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40027
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017172 Nonsense 808 973 24 28
ENSDART00000125268   None 686 None 21
ENSDART00000127309   None 683 None 20
ENSDART00000130575   None 398 None 15
ENSDART00000136465   None 398 None 15
ENSDART00000140067 Nonsense 805 970 23 27
Genomic Location (Zv9):
Chromosome 3 (position 16013638)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 16243857
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATCCTGGATGCCGTGATTGCTCAGGAGCCGCTGCACAGAGGAGGAGGA[C/T]AAGTCATCCCTACAGCTCGCAGAGTTGTCTACTCCGCTTTCCTCATGGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link