ube2e3

Ensembl ID:
ENSDARG00000012244
ZFIN ID:
ZDB-GENE-030131-408
Description:
ubiquitin-conjugating enzyme E2 E3 [Source:RefSeq peptide;Acc:NP_957215]
Human Orthologue:
UBE2E3
Human Description:
ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog, yeast) [Source:HGNC Symbol;Acc:12479]
Mouse Orthologue:
Ube2e3
Mouse Description:
ubiquitin-conjugating enzyme E2E 3, UBC4/5 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:107412]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17991 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17991
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020550 Essential Splice Site None 209 1 6

The following transcripts of ENSDARG00000012244 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 44871292)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTTTTAACACTCCTAACCACCCCAGTTCAGGACAGGACCGCRTCTAAG[G/A]TAAAGGAGAAGCTCTAAGGGTCTCGTAGAGTCCACKTTAGGCGGGGTAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9xv8tig7