dpf2

Ensembl ID:
ENSDARG00000012219
ZFIN ID:
ZDB-GENE-041024-2
Description:
D4, zinc and double PHD fingers family 2 [Source:RefSeq peptide;Acc:NP_001007153]
Human Orthologue:
DPF2
Human Description:
D4, zinc and double PHD fingers family 2 [Source:HGNC Symbol;Acc:9964]
Mouse Orthologue:
Dpf2
Mouse Description:
D4, zinc and double PHD fingers family 2 Gene [Source:MGI Symbol;Acc:MGI:109529]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20484 Essential Splice Site Available for shipment Available now
sa16212 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20484
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014031 Essential Splice Site 191 400 5 11
Genomic Location (Zv9):
Chromosome 5 (position 39350231)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37149915
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATTATGAGGAAGATACTCCAAAGAAACGTGGAAAAGGCAAAGGAAAG[G/A]TGAGATCTCATCAATTTTCCTTCTTGAACAGATAGGGGACTTAAGAGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16212
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014031 Essential Splice Site 374 400 10 11
Genomic Location (Zv9):
Chromosome 5 (position 39356160)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37155844
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTACCACATGTACTGCCTCTCTCCCCCAATGTCTGTACCTCCTGAAGG[T/C]AAAACAACATTACRGTAGTAGTTCCATAAACAAAAGATATACTCACCGGNC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link