papolg

Ensembl ID:
ENSDARG00000012141
ZFIN ID:
ZDB-GENE-040426-1256
Description:
poly(A) polymerase gamma [Source:RefSeq peptide;Acc:NP_956915]
Human Orthologue:
PAPOLG
Human Description:
poly(A) polymerase gamma [Source:HGNC Symbol;Acc:14982]
Mouse Orthologue:
Papolg
Mouse Description:
poly(A) polymerase gamma Gene [Source:MGI Symbol;Acc:MGI:2442119]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1701 Essential Splice Site F2 line generated During 2017
sa22310 Nonsense Available for shipment Available now
sa30972 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa1701
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015154 Essential Splice Site 84 744 3 23
ENSDART00000124089 Essential Splice Site 84 744 3 24

The following transcripts of ENSDARG00000012141 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 26060957)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25706617
KASP Assay ID:
554-1647.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTAAATTCGTTTGTGAAGGAGTGGATTTCTGAAATCAGTGAATCAAAG[G/T]TAGGTAAACCTGCAGGTTTCTTAGTTTGATCATCAGGTTGGATGAGATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22310
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015154 Nonsense 301 744 10 23
ENSDART00000124089 Nonsense 301 744 10 24

The following transcripts of ENSDARG00000012141 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 26056431)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25702091
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGTGCTTTTAAAACAACCCGAAGACAGCAATTTGAATCTGCCGGTCTG[G/A]GATCCACGGGTCAGCACTCATGTTCATTGTGATTAATATACTGTTCTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30972
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015154 Essential Splice Site 468 744 15 23
ENSDART00000124089 Essential Splice Site 468 744 15 24

The following transcripts of ENSDARG00000012141 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 26053751)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25699411
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGAATATTGACTTGACCTACGACATTCAGTCTTTCACAGATACTGG[T/A]AAGCTGCTCCTGAATTTTATTAAATTACATTGCTACCTTTTAATATCCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link