sgce

Ensembl ID:
ENSDARG00000012138
ZFIN ID:
ZDB-GENE-030724-1
Description:
epsilon-sarcoglycan [Source:RefSeq peptide;Acc:NP_001002594]
Human Orthologue:
SGCE
Human Description:
sarcoglycan, epsilon [Source:HGNC Symbol;Acc:10808]
Mouse Orthologue:
Sgce
Mouse Description:
sarcoglycan, epsilon Gene [Source:MGI Symbol;Acc:MGI:1329042]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36898 Nonsense Available for shipment Available now
sa23581 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36898
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102807 Nonsense 334 429 8 11
ENSDART00000111982 Nonsense 343 414 9 11
ENSDART00000131865 Nonsense 27 122 2 5
Genomic Location (Zv9):
Chromosome 19 (position 42006407)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 41458661
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGTATTTGCTCTGTCAGCATTCAGCTGGTTCACCACAGCTCCATTCAG[A/T]AGTCCACTAAGGAGCTCCGCGGGATGTCGAAGAACCGGGAGATTTCGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23581
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102807 Essential Splice Site 401 429 9 11
ENSDART00000111982 Essential Splice Site 410 414 10 11
ENSDART00000131865 Essential Splice Site 94 122 3 5
Genomic Location (Zv9):
Chromosome 19 (position 42002553)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 41454807
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAGAAATTTACAGAATCAGATCCAAATACCACAGCAGCAGACTTCTGG[T/G]AAGTGTATCATCATTTATATTAGATTAGGTCAGATTAGATTAGATTAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link