cyp46a1

Ensembl ID:
ENSDARG00000012137
ZFIN IDs:
ZDB-GENE-050522-464, ZDB-GENE-051120-33
Description:
cytochrome P450, family 46, subfamily A, polypeptide 1 [Source:RefSeq peptide;Acc:NP_001018358]
Human Orthologue:
CYP46A1
Human Description:
cytochrome P450, family 46, subfamily A, polypeptide 1 [Source:HGNC Symbol;Acc:2641]
Mouse Orthologue:
Cyp46a1
Mouse Description:
cytochrome P450, family 46, subfamily a, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:1341877]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39269 Nonsense Mutation detected in F1 DNA During 2016
sa23632 Essential Splice Site Mutation detected in F1 DNA During 2016
sa17707 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39269
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028039 Nonsense 76 501 3 15
ENSDART00000081351 Nonsense 76 296 3 9

The following transcripts of ENSDARG00000012137 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 5148828)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATTGTTTAATAATTCTGTTGTATAATTCTTTTTAAGGGCAGAAAAATA[T/A]GGCCCTGTTTACAGGATTAACACTTTGCATTATGTCACAATAGTGGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23632
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028039 Essential Splice Site 314 501 9 15
ENSDART00000081351   None 296 None 9

The following transcripts of ENSDARG00000012137 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 5156568)
KASP Assay ID:
2261-3927.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGATCTTGAGCAGATGTTGGACAATTTTGTGACTTTCTTCATTGCTGG[T/A]GAGTTAGTGCTCATGTCGATGAACTTGAAGTGCTTTTGTTGCATACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17707
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028039 Nonsense 446 501 14 15
ENSDART00000081351   None 296 None 9

The following transcripts of ENSDARG00000012137 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 5160771)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTATCTAAAGGCCTTATTACTGCTACTACCCATTTTCACTTGGTCCA[C/T]GAACCTGTCTTGGCCAGGTCTTCGCACAGGTGATGAAACACACACATGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link