fbxl2

Ensembl ID:
ENSDARG00000012135
ZFIN ID:
ZDB-GENE-030925-12
Description:
F-box/LRR-repeat protein 2 [Source:RefSeq peptide;Acc:NP_956400]
Human Orthologue:
FBXL2
Human Description:
F-box and leucine-rich repeat protein 2 [Source:HGNC Symbol;Acc:13598]
Mouse Orthologue:
Fbxl2
Mouse Description:
F-box and leucine-rich repeat protein 2 Gene [Source:MGI Symbol;Acc:MGI:1919429]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15554 Nonsense Available for shipment Available now
sa4064 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15554
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018328 Nonsense 84 432 5 14
ENSDART00000126558 Nonsense 157 505 5 14
Genomic Location:
Chromosome 19 (position 44269980)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTAMATCTTTCTTTCTCTCAGGGTCGKGTTGTGGAGAACATCTCAAAG[C/T]GATGTGGAGGTTTTTTRAGGCAGCTCAGTCTCMGGGGYTGCCTCAGTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4064
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018328 Nonsense 167 432 7 14
ENSDART00000126558 Nonsense 240 505 7 14
Genomic Location:
Chromosome 19 (position 44275625)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACTCTCTTTATTTGTGTTTTCTGTTGGCTAGTGAGGGCTGTCGGATGT[T/A]GGAGAACCTGAATCTGTCCTGGTGTGATCAGATCACGAGTGATGGCATTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8hpyzpjd