si:ch211-9d9.3

Ensembl ID:
ENSDARG00000012130
ZFIN ID:
ZDB-GENE-060503-139
Description:
Novel protein similar to vertebrate transglutaminase 1, K polypeptide (TGM1) [Source:UniProtKB/TrEMB
Human Orthologue:
TGM1
Human Description:
transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase) [So
Mouse Orthologue:
Tgm1
Mouse Description:
transglutaminase 1, K polypeptide Gene [Source:MGI Symbol;Acc:MGI:98730]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9251 Nonsense Mutation detected in F1 DNA During 2017
sa12888 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9251
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027444 Nonsense 134 783 2 13
ENSDART00000140097 Nonsense 167 816 3 14
Genomic Location (Zv9):
Chromosome 2 (position 51705888)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 52107441
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCATCACACKGAWCAGTACAGTGGAGATCAGCTGATCATCCGCAGAGGA[C/T]AGACTTTCCAGATTGAGCTGGAGCTCTCACGACCCTTCAACCCAAACACY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12888
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027444 Nonsense 333 783 6 13
ENSDART00000140097 Nonsense 366 816 7 14
Genomic Location (Zv9):
Chromosome 2 (position 51717273)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 52096056
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTTGTAGATCAACTCTCCGGATGACCGTGGTGTTCTGGAGGGAAACTG[G/A]TCTGGGAATTACRCTGGAGGAAYGTCTCCCACCGCATGGAGTGGMAGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link