meis1

Ensembl ID:
ENSDARG00000012078
ZFIN ID:
ZDB-GENE-020122-1
Description:
homeobox protein Meis1 [Source:RefSeq peptide;Acc:NP_571968]
Human Orthologue:
MEIS1
Human Description:
Meis homeobox 1 [Source:HGNC Symbol;Acc:7000]
Mouse Orthologue:
Meis1
Mouse Description:
Meis homeobox 1 Gene [Source:MGI Symbol;Acc:MGI:104717]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19051 Nonsense Mutation detected in F1 DNA During 2014
sa9839 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19051
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102576 Nonsense 91 388 3 13
ENSDART00000125383 Nonsense 91 463 2 11
ENSDART00000102576 Nonsense 91 388 3 13
ENSDART00000125383 Nonsense 91 463 2 11

The following transcripts of ENSDARG00000012078 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 5242785)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTTATTCCAGGCACCCCTTGTTCCCTCTTCTAGCACTGATTTTTGAG[A/T]AATGTGAATTAGCCACTTGCACACCTAGAGAACCCGGTGTTGCTGGGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9839
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102576 Nonsense 91 388 3 13
ENSDART00000125383 Nonsense 91 463 2 11
ENSDART00000102576 Nonsense 91 388 3 13
ENSDART00000125383 Nonsense 91 463 2 11

The following transcripts of ENSDARG00000012078 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 5242785)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTTTATTCCAGGCACCCCTTGTTCCCTCTTCTWGCACTGATTTTTGAG[A/T]AATGTGAATTAGCCACTTGCACACCTAGAGAACCCGGTGTTGCTGGGGGC
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
eye
ZFA:0000107
quality
PATO:0000001
normal
PATO:0000461
Larval:Day 5
ZFS:0000037
heart
ZFA:0000114
quality
PATO:0000001
normal
PATO:0000461
Larval:Day 5
ZFS:0000037
mandibular arch skeleton
ZFA:0001227
quality
PATO:0000001
normal
PATO:0000461
Larval:Day 5
ZFS:0000037
swim bladder
ZFA:0000076
aplastic
PATO:0001483
abnormal
PATO:0000460

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/06lbext5