meis1

Ensembl ID:
ENSDARG00000012078
ZFIN ID:
ZDB-GENE-020122-1
Description:
homeobox protein Meis1 [Source:RefSeq peptide;Acc:NP_571968]
Human Orthologue:
MEIS1
Human Description:
Meis homeobox 1 [Source:HGNC Symbol;Acc:7000]
Mouse Orthologue:
Meis1
Mouse Description:
Meis homeobox 1 Gene [Source:MGI Symbol;Acc:MGI:104717]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19051 Nonsense Mutation detected in F1 DNA During 2016
sa9839 Nonsense Available for shipment Available now
sa35409 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa19051
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102576 Nonsense 91 388 3 13
ENSDART00000125383 Nonsense 91 463 2 11
ENSDART00000102576 Nonsense 91 388 3 13
ENSDART00000125383 Nonsense 91 463 2 11

The following transcripts of ENSDARG00000012078 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 5242785)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 5437563
KASP Assay ID:
2260-5983.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTTATTCCAGGCACCCCTTGTTCCCTCTTCTAGCACTGATTTTTGAG[A/T]AATGTGAATTAGCCACTTGCACACCTAGAGAACCCGGTGTTGCTGGGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9839
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102576 Nonsense 91 388 3 13
ENSDART00000125383 Nonsense 91 463 2 11
ENSDART00000102576 Nonsense 91 388 3 13
ENSDART00000125383 Nonsense 91 463 2 11

The following transcripts of ENSDARG00000012078 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 5242785)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 5437563
KASP Assay ID:
2260-5983.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTTTATTCCAGGCACCCCTTGTTCCCTCTTCTWGCACTGATTTTTGAG[A/T]AATGTGAATTAGCCACTTGCACACCTAGAGAACCCGGTGTTGCTGGGGGC
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
eye
ZFA:0000107
quality
PATO:0000001
normal
PATO:0000461
Larval:Day 5
ZFS:0000037
heart
ZFA:0000114
quality
PATO:0000001
normal
PATO:0000461
Larval:Day 5
ZFS:0000037
mandibular arch skeleton
ZFA:0001227
quality
PATO:0000001
normal
PATO:0000461
Larval:Day 5
ZFS:0000037
swim bladder
ZFA:0000076
aplastic
PATO:0001483
abnormal
PATO:0000460

Mutation Details

Allele Name:
sa35409
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102576 Essential Splice Site 208 388 None 13
ENSDART00000125383 Essential Splice Site 208 463 None 11

The following transcripts of ENSDARG00000012078 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 5240841)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 5435619
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAATCAGACAGTGAAGAAATTACGAGATCATCGGGGCCCCTTGATCAGG[T/C]ACGTGGTGGAGTCCATTTCTTTTCTGGCCATTCAGACCGTCTTTTGGGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link