apoa1

Ensembl ID:
ENSDARG00000012076
ZFIN ID:
ZDB-GENE-990415-14
Description:
Apolipoprotein A-I [Source:UniProtKB/Swiss-Prot;Acc:O42363]
Human Orthologues:
APOA1, APOA4, APOA5
Human Descriptions:
apolipoprotein A-I [Source:HGNC Symbol;Acc:600]
apolipoprotein A-IV [Source:HGNC Symbol;Acc:602]
apolipoprotein A-V [Source:HGNC Symbol;Acc:17288]
Mouse Orthologues:
Apoa1, Apoa4, Apoa5
Mouse Descriptions:
apolipoprotein A-I Gene [Source:MGI Symbol;Acc:MGI:88049]
apolipoprotein A-IV Gene [Source:MGI Symbol;Acc:MGI:88051]
apolipoprotein A-V Gene [Source:MGI Symbol;Acc:MGI:1913363]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10582 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10582
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012050 Nonsense 160 262 4 4
Genomic Location:
Chromosome 5 (position 39581519)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAGGAGTACTCCGCTCTGAACCGCCAAAATGCTGAGCAGCTGCGTGCC[A/T]AGCTGGAGCCCCTGATGGACGACATTAGGAAGGCCTTCGAGTCCRACATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ah8jtbo4