kif15

Ensembl ID:
ENSDARG00000012073
ZFIN ID:
ZDB-GENE-050622-16
Description:
Wu:fc51g12 protein [Source:UniProtKB/TrEMBL;Acc:A0JPF4]
Human Orthologue:
KIF15
Human Description:
kinesin family member 15 [Source:HGNC Symbol;Acc:17273]
Mouse Orthologue:
Kif15
Mouse Description:
kinesin family member 15 Gene [Source:MGI Symbol;Acc:MGI:1098258]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5112 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10447 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5112
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099866 Essential Splice Site 7 1378 None 35
ENSDART00000099868 Essential Splice Site 7 1010 None 25
ENSDART00000130782 None None 1372 None 34

The following transcripts of ENSDARG00000012073 do not overlap with this mutation:

Genomic Location:
Chromosome 25 (position 36155558)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTGTAGTTTTGTTATTAAATGTGTTTTTGTGYTATSTGTTTCATATGC[A/T]GCAACTGCGGAAGCAAACACCAACWGGTACATCAATAATAATTCACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10447
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099866 Nonsense 1034 1378 26 35
ENSDART00000099868 None None 1010 None 25
ENSDART00000130782 Nonsense 1016 1372 25 34

The following transcripts of ENSDARG00000012073 do not overlap with this mutation:

Genomic Location:
Chromosome 25 (position 36135409)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAKGGYTTTCTGTGCAGGGAAAGTACAGCGCAGTGTGTGCWGAGAAGGAG[C/T]AGATGAAGGAGAGCATCACACGMATGAAAAGTGAACTGCAGGAGCTGCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3cnd2chy