dcn

Ensembl ID:
ENSDARG00000012066
ZFIN ID:
ZDB-GENE-010102-1
Description:
decorin [Source:RefSeq peptide;Acc:NP_571772]
Human Orthologue:
DCN
Human Description:
decorin [Source:HGNC Symbol;Acc:2705]
Mouse Orthologue:
Dcn
Mouse Description:
decorin Gene [Source:MGI Symbol;Acc:MGI:94872]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20247 Nonsense Available for shipment Available now
sa14267 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20247
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013085 Nonsense 128 373 4 8
ENSDART00000123552 Nonsense 128 373 3 7
Genomic Location (Zv9):
Chromosome 4 (position 15451229)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16394069
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATAACTAATATAATGTGCTCTTTTTAGACGCTCATCTTGGTCAACAAT[A/T]AGATCACTATCATTCATGCGAAGGCGTTTTCTTCTCTGATCAATCTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14267
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013085 Nonsense 216 373 5 8
ENSDART00000123552 Nonsense 216 373 4 7
Genomic Location (Zv9):
Chromosome 4 (position 15448630)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16391470
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTCSGGAGTCGATAATGGGGCTTTTGCTGATCTGAAGAGGGTCTCTTA[C/A]ATCCGAATCGCCRACACCAACCTCACCTCTATTCCCAAAGGTACTGAATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Sudden cardiac arrest: GWAS for discovery and replication of genetic loci associated with sudden cardiac arrest in patients with coronary artery disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link