thbs3b

Ensembl ID:
ENSDARG00000012060
ZFIN ID:
ZDB-GENE-060503-84
Description:
Thrombospondin-3b [Source:UniProtKB/Swiss-Prot;Acc:Q1L8P7]
Human Orthologue:
THBS3
Human Description:
thrombospondin 3 [Source:HGNC Symbol;Acc:11787]
Mouse Orthologue:
Thbs3
Mouse Description:
thrombospondin 3 Gene [Source:MGI Symbol;Acc:MGI:98739]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17980 Nonsense Available for shipment Available now
sa13482 Nonsense Available for shipment Available now
sa23526 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17980
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043133 Nonsense 501 906 13 22
ENSDART00000090825 Nonsense 524 929 14 23
Genomic Location:
Chromosome 19 (position 24913924)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCCTATGGTGATGCTTGCGACAACTGCCCCAACGTACCCAACGGCGAT[C/T]AGCTTGATACTGATGGCAATGGCAAGGGAGACATCTGTGACACTGATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13482
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043133 Nonsense 526 906 14 22
ENSDART00000090825 Nonsense 549 929 15 23
Genomic Location:
Chromosome 19 (position 24913766)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATCATCTGTCTTTACCACTGATTTTCTTTACAGGGATCCCTAACGTTT[T/A]RGATAACTGTCCTAAAATACCCAACCCCATGCAGACAGACCGAGATGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23526
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043133 Nonsense 583 906 16 22
ENSDART00000090825 Nonsense 606 929 17 23
Genomic Location:
Chromosome 19 (position 24911309)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAAAGCTCTAATGAAAATGACTGTCTGTGTGTAGTGATGGTGATGGATA[T/A]CAGGACACCAGGGATAACTGTCCTGAAGTGCCCAACAGTTCTCAGCTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/onno5u9p