mtnr1al

Ensembl ID:
ENSDARG00000012057
ZFIN ID:
ZDB-GENE-990415-154
Description:
Melatonin receptor type 1A-like [Source:UniProtKB/Swiss-Prot;Acc:P51047]
Human Orthologue:
MTNR1A
Human Description:
melatonin receptor 1A [Source:HGNC Symbol;Acc:7463]
Mouse Orthologue:
Mtnr1a
Mouse Description:
melatonin receptor 1A Gene [Source:MGI Symbol;Acc:MGI:102967]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10503 Nonsense Available for shipment Available now
sa10002 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10503
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131008 Nonsense 25 344 1 2
Genomic Location:
Chromosome 14 (position 27103644)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCGTGGCACGGAGGACCGGACCCCTCGCCGCTGTCCTGTTAYGATGAAT[T/A]GAGGATGGTGGAGGGAACAGACGCCCCATTGAAGAWCATTTCGACAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10002
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131008 Nonsense 102 344 2 2
Genomic Location:
Chromosome 14 (position 27086140)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCTTTACAGGAAATGCCTTTGTGGTGAGTTTGGCTATAGCAGATCTGW[T/G]AGTGGCCATCTACCCCTACCCGCTTGTCCTGACCGCCATCTTCCACGACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Obesity: A genome-wide association study on obesity and obesity-related traits. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/oed2lkzc