mtnr1al

Ensembl ID:
ENSDARG00000012057
ZFIN ID:
ZDB-GENE-990415-154
Description:
Melatonin receptor type 1A-like [Source:UniProtKB/Swiss-Prot;Acc:P51047]
Human Orthologue:
MTNR1A
Human Description:
melatonin receptor 1A [Source:HGNC Symbol;Acc:7463]
Mouse Orthologue:
Mtnr1a
Mouse Description:
melatonin receptor 1A Gene [Source:MGI Symbol;Acc:MGI:102967]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10503 Nonsense Available for shipment Available now
sa38998 Nonsense Mutation detected in F1 DNA During 2016
sa10002 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10503
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131008 Nonsense 25 344 1 2
Genomic Location (Zv9):
Chromosome 14 (position 27103644)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 25796846
KASP Assay ID:
2260-7572.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCGTGGCACGGAGGACCGGACCCCTCGCCGCTGTCCTGTTAYGATGAAT[T/A]GAGGATGGTGGAGGGAACAGACGCCCCATTGAAGAWCATTTCGACAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38998
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131008 Nonsense 81 344 1 2
Genomic Location (Zv9):
Chromosome 14 (position 27103477)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 25796679
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATTGTAGTAGATGTTCTGGGCAACCTGTTGGTCATTGTGTCAGTCTTC[A/T]GAAACAGAAAGCTCAGGAAGGCAGGTAAATGTCTTCATCTCTTTAATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10002
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131008 Nonsense 102 344 2 2
Genomic Location (Zv9):
Chromosome 14 (position 27086140)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 25779342
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCTTTACAGGAAATGCCTTTGTGGTGAGTTTGGCTATAGCAGATCTGW[T/G]AGTGGCCATCTACCCCTACCCGCTTGTCCTGACCGCCATCTTCCACGACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Obesity: A genome-wide association study on obesity and obesity-related traits. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link