LOC557995

Ensembl ID:
ENSDARG00000012040
Human Orthologue:
RNF19A
Human Description:
ring finger protein 19A [Source:HGNC Symbol;Acc:13432]
Mouse Orthologues:
1700001J11Rik, Rnf19a
Mouse Descriptions:
RIKEN cDNA 1700001J11 gene Pseudogene [Source:MGI Symbol;Acc:MGI:1919474]
ring finger protein 19A Gene [Source:MGI Symbol;Acc:MGI:1353623]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23479 Essential Splice Site Mutation detected in F1 DNA During 2014
sa14753 Nonsense Available for shipment Available now
sa23478 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23479
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024193 Essential Splice Site 464 913 5 10
Genomic Location:
Chromosome 19 (position 12669000)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCCATACCCGCGATGATCATTGGGATACCGGTGTATGTGGGAAGAAAG[G/T]TGGGTGGTCGTCTTTAAATGTTAAAAATGAAGGGTGAGGTGTACATGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14753
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024193 Nonsense 887 913 10 10
Genomic Location:
Chromosome 19 (position 12655409)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTACATTGCAGAGGAGAATGTGAGTTTAATGTGTGCGGCTAATGCGAGC[C/T]AGAGCTCGCCTAAAGAACGCAATAACAAYCTTCCTCAGCCAGCTAGCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23478
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024193 Nonsense 912 913 10 10
Genomic Location:
Chromosome 19 (position 12655334)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAACCTTCCTCAGCCAGCTAGCCCTGTGCGCAACACCTGCATTCAAACC[G/T]AGATATAACCAGACGGGTCGACTTCACCCAAAATGCTTTCACAGCTAACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5fzux9tc