ttc26

Ensembl ID:
ENSDARG00000012039
ZFIN ID:
ZDB-GENE-041212-41
Description:
Tetratricopeptide repeat protein 26 [Source:UniProtKB/Swiss-Prot;Acc:Q5PR66]
Human Orthologue:
TTC26
Human Description:
tetratricopeptide repeat domain 26 [Source:HGNC Symbol;Acc:21882]
Mouse Orthologue:
Ttc26
Mouse Description:
tetratricopeptide repeat domain 26 Gene [Source:MGI Symbol;Acc:MGI:2444853]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20630 Essential Splice Site Mutation detected in F1 DNA During 2014
sa20629 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20630
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032494 Essential Splice Site 338 557 10 17

The following transcripts of ENSDARG00000012039 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 7616751)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATCCTGAAAGGGGTGGTTAATGCTGCTTTGGGACAAGAAATCGGATCG[G/A]TTAGCAAACTTTTATTTCCTCTTATTTTTTTTTCTCAGTGAATCCTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20629
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032494 Essential Splice Site 417 557 13 17

The following transcripts of ENSDARG00000012039 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 7614152)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACGCTCAGGCCAAGGCGGCTCTCGGGAACTACAGAGAAGCTGAAGAGG[T/C]ACACATACTCATAATTCAGAAAATATGTTATTGTATAATATGAATTACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/emt0fay8