lrrc50

Ensembl ID:
ENSDARG00000012030
ZFIN ID:
ZDB-GENE-031114-4
Description:
Leucine-rich repeat-containing protein 50 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZV84]
Human Orthologue:
LRRC50
Human Description:
leucine rich repeat containing 50 [Source:HGNC Symbol;Acc:30539]
Mouse Orthologue:
Lrrc50
Mouse Description:
leucine rich repeat containing 50 Gene [Source:MGI Symbol;Acc:MGI:1915520]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20957 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20957
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099272 Nonsense 76 548 3 11
ENSDART00000145762 Nonsense 80 562 3 10
Genomic Location:
Chromosome 7 (position 30350084)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAAGAAAAACAAACTGTACCTGACACCAAGGCTGAATGACACACTTTA[T/A]CTTCACTTTAAAGGTTTGAAATTGCTTAAACAAAAGAGACTAATTTTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/j3ijw52q