kdsr

Ensembl ID:
ENSDARG00000012021
ZFIN ID:
ZDB-GENE-040426-853
Description:
3-ketodihydrosphingosine reductase [Source:RefSeq peptide;Acc:NP_957433]
Human Orthologue:
KDSR
Human Description:
3-ketodihydrosphingosine reductase [Source:HGNC Symbol;Acc:4021]
Mouse Orthologue:
Kdsr
Mouse Description:
3-ketodihydrosphingosine reductase Gene [Source:MGI Symbol;Acc:MGI:1918000]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25779 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25779
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022621 Essential Splice Site 120 193 3 5
ENSDART00000126874 Essential Splice Site 286 359 8 10
Genomic Location (Zv9):
Chromosome 2 (position 13034113)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 13559338
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTCTCAACCGGAGCAAGTGGCAAAAATTGTGGTGAAAGATGCGGTGG[T/A]GAGTACATGGTGGCTCTTATGTGACAAGTTTCAAGACAGAAAAACTTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link